Quick Taq HS DyeMix, 1 pack

Product#: TYB-DTM-101
$68.16
Availability:
Ships in 24 hours

PCR Master Mix

Quick Taq® HS DyeMix

A Taq-based 2× master mix for hot start PCR with built-in bromophenol blue (BPB) loading dye — load amplified products directly onto agarose or acrylamide gels.

Shipping notice. This product has ICE or DRY ICE shipping requirements, DO NOT select Ground Shipping.

$1.00  is only for sample (please inquire)

Cat No.
TYB-DTM-101
UNSPSC Code
12352204
Size
2 x 1.25ml
Storage Temp.
-20 °C (4 °C / month)  | Ships on Dry Ice

Ordering

100 rxn, 50 µl per reaction. Cat No. list below.

Ordering & Pack Sizes
Product Name Cat No. Size Storage Order
Quick Taq™ HS DyeMix, Trial TYB-DTM-101S 1.25ml Store at -20 °C ( 4 °C for a month ) Order
Quick Taq™ HS DyeMix, 1 pack TYB-DTM-101 2 x 1.25ml Store at -20 °C ( 4 °C for a month ) Current page
Quick Taq™ HS DyeMix, 5 pack TYB-DTM-101-5PK (2 x 1.25ml) X 5 Store at -20 °C ( 4 °C for a month ) Order
Quick Taq™ HS DyeMix, 10 pack TYB-DTM-101-10PK (2 x 1.25ml) X 10 Store at -20 °C ( 4 °C for a month ) Order

Description

Quick Taq® HS DyeMix is a Taq-based 2x master mix PCR reagent that contains an electrophoresis dye (BPB; bromophenol blue) and anti-Taq antibodies for hot start PCR. This reagent contains all components for PCR except primers and template DNA. This reagent shows specific and efficient amplification. The amplified products can be directly loaded in the wells of agarose or acrylamide gels.

Features

Direct gel loading

Quick Taq® HS DyeMix contains bromophenol blue (BPB) as an electrophoresis dye; the PCR products can be analyzed directly with an agarose or acrylamide gel.

Greater performance

Enables greater PCR performance than conventional Taq DNA polymerase.

Hot start

This reagent contains anti-Taq antibodies for hot start PCR. Hot start technology realizes highly specific and sensitive PCR.

Stable

Quick Taq® HS DyeMix is stable for at least three months at 4ºC. No decrease in reaction efficiency is observed following 30 freeze-thaw cycles.

Applications

For routine PCR in the lab only.

  • Genotyping
  • Colony PCR
  • DNA Fingerprinting or routine Forensic PCR
  • Template Verification PCR
  • Validation of PCR bands
  • Gene Expression Analyses
  • Mutation Detection
  • Routine Screening and High Throughput PCR
  • Restriction Fragment Length Polymorphism (RFLP) Analyses
  • Direct Genomic PCR

* Not high fidelity. NOT Recommend for PCR for sequencing and cloning purposes.

Components

This reagent includes the following components for 100 reactions, 50 µl total reaction volume:
2x Quick Taq® HS DyeMix 1.25ml× 2
*In the case of the long-term storage (>3 months), this reagent should be stored at -20ºC.

Typical PCR Reaction Setup

Component Volume Final Concentration
Quick Taq® HS DyeMix 25 µl 1x
10 pmol /µl Primer #1 1.0 µl 0.2 µM
10 pmol /µl Primer #2 1.0 µl 0.2 µM
Template DNA X µl Genomic DNA ≤ 200 ng/50 µl
Plasmid DNA ≤ 50 ng/50 µl
Colony
PCR grade water Y µl  
Total reaction volume 50 µl  

* Do not use dNTPs from other kits or companies.

PCR Cycle Conditions

DTM-101_pcrCycle.png

We recommend trying 3-step cycles when the Tm of primers is under 73ºC.

Application Data

Example 1. Amplification of the human p53 genes (2.9 kb)

The human p53 genes (2.9 kb) was amplified using 50 ng of human genomic DNA. Quick Taq® HS DyeMix successfully amplified the targets.

DTM-101_Example1.png

M: 1 kb Ladder
1: Quick Taq® HS DyeMix
2: rTaq DNA polymerase (hot start)
3: rTaq DNA polymerase
4: Taq Master Mix (Company A)
Template: Human genomic DNA 50 ng / 50 µl reaction
Forward Primer: AATGGATGATTTGATGCTGTCCC
Reverse Primer: ATAAGAGCTCCCAAGACTTAG
*Final concentration 0.2 µM

Example 2. Insert amplification by a colony-direct PCR

The inserts were amplified using Quick Taq® HS DyeMix with universal primers from E. coli DH5α colonies bearing pTA2 plasmid (insert size: 500 bp). Quick Taq® HS DyeMix successfully and efficiently amplified all targets.

DTM-101_Example2-1.png
DTM-101_Example2-2.png
M: 100 bp Ladder Markers
1: Colony (insert +)
2: Colony (insert -)
3: Colony (insert +)
4: Colony (insert +)
5: Colony (insert +)
N: Negative Control
M: 100 bp Ladder Marker

Forward Primer: CGCCAGGTTTTCCCAGTCACGAC
Reverse Primer: AGCGGATAACAATTTCACACAGGAAAC
*Final concentration 0.2 µM

Quick Taq® HS DyeMix — Performance Highlights

Feature:

Taq Master Mix + Loading Dye
From "No band" to "YES BAND" during Genotyping
Immediate Loading PCR after High Throughput Run
Robust PCR + Dye loading Save Time
Lowest Price in the Market keeping the better result

1.  Mouse Ear Punch Genotyping: Quick Taq Master Mix can change from NO band to YES band and is far superior to Thermo Fisher Taq Polymerase+Buffer

Compared with "Thermo Fisher Scientific's Taq polymerase and Buffer"

Thermo Fisher Scientific's Taq polymerase and Buffer

With Diagnocine's Toyobo brand, "Quick Taq HS DyeMix"

*Data kindly provided by NIAID/NIH lab

From "No band" to "YES BAND" during Genotyping
40% to 80% Lower Cost than BioRad, Qiagen, Promega, and "Thermo Fisher Scientific" brands

Up to Ten Times greater Intensity than "Thermo Fisher Scientific" Taq Polymerase
Multipurpose Routine PCR
Colony and Multipurpose Screening
KnockOut, KnockIn, Transgenic, Mouse Tail, Large Scale High-throughput

2.  Genomic DNA PCR: Quick Taq generates endpoint PCR bands 7 times brighter and thicker than Thermos Fisher Taq polymerase+buffer

TOYOBO "Quick Taq HS DyeMix" is superior to leading competitors

Diagnocine's Toyobo  VS Thermo Fisher Scientific

*Data kindly provided by NIAID/NIH lab

3.  Minimal sample PCR: Quick Taq Master Mix amplify at least 5 times better than Thermo Fisher Dream Taq

PCR of human IL-15cDNA and PCR of human IL-21cDNA

M : 1Kb Plus DNA Ladder
1. PCR of IL-15 + IL-21 using Green Dream Taq 2X MM (Thermo Fisher)
2. PCR of IL-15 + IL-21 using Quick Taq HSDyeMix (TOYOBO) Diagnocine
*Data kindly provided by NIAID/NIH lab

4.  Mouse Tail Genotyping: Quick Taq Master Mix is more than 10 fold greater to produce sharp bands when compared to Thermos Fisher Taq 2X Master Mix

Genotyping Data, 2XMM

*Data kindly provided by NIAID/NIH lab

5.  Quick Taq Master Mix generates clean and sharp heterogeneous two bands for genotyping

Genotyping results from mousetail

*Data kindly provided by NIAID/NIH lab

6.  Transgenic Selection Tail Genotyping:  Quick Taq Master Mix correctly identifies positive Transgenic Mice with 'Tough Template' PCR

The images show screenings of positive transgenic mice, of which you will see a sequencing result confirmed the specificity of DyeMix PCR result.

*Data kindly provided by Transgenic Core, NIAID/NIH lab

7.  Mouse Tail Genotyping is easy and clean bands every time with Quick Taq Master Mix

Genotyping results

*Data kindly provided by NIAID/NIH lab

8.  Routine colony screening; Quick Taq generates thicker and 3 times brighter PCR bands than Thermo Fisher Taq master mix

“Toyobo Quick Taq HS DyeMix is brighter and has a higher density than our lab’s Taq mix.”

*Data provided by the Department of Medicine (Hematology), Albert Einstein College of Medicine

Related Product

** Less than 10 min Mouse Genotyping and Routine Screening

On This Page

Satisfaction
Quality Rating
Value Rating
Style Rating
X