KOD One™ PCR Master Mix, 10 pack
KOD One™ PCR Master Mix, 10 pack
A 2× hot-start master mix powered by genetically modified KOD DNA polymerase (UKOD) and a new Elongation Accelerator — ultra-fast 5 sec/kb extension, ~80× higher fidelity than Taq, and superior amplification from crude, GC-rich, and tough templates.
// Ships on Dry Ice
Try it first. A trial size (Cat No. TYB-KMM-101S, limit one per customer) is available so you can validate KOD One™ on your own tough templates before scaling up to 1-, 5-, or 10-pack quantities.
Description
KOD One™ PCR Master Mix and KOD One™ PCR Master Mix -Blue- are 2× PCR master mixes based on genetically modified KOD DNA polymerase (UKOD). The KOD One™ series enables fast PCR, with an extension time of 5 sec/kb by applying UKOD and a new Elongation Accelerator. In addition, these master mixes provide greater efficiency and elongation capabilities than conventional PCR enzymes. In particular, they show greater amplification success from crude specimens. Furthermore, these master mixes can be applied to amplify from templates containing uracils (dU) or using primers containing inosines (dI) and uracils (dU).
The KOD One™ series contains two types of anti-KOD DNA polymerase antibodies that inhibit the polymerase and 3′→5′ exonuclease activities, thus allowing for Hot Start PCR. These master mixes generate blunt-end PCR products because of the 3′→5′ exonuclease (proof-reading) activity of KOD DNA polymerase.
Features
Five reasons KOD One™ outperforms conventional PCR enzymes.
Amplifies targets under very short conditions — ≤1 kb: 1 sec; 1–10 kb: 5 sec/kb; >10 kb: 10 sec/kb. Cycling conditions can be set flexibly when amplifying various targets of different sizes.
Contains all reaction components except primers and templates, giving high reproducibility by reducing pipetting steps. The -Blue- version includes a loading dye (BPB) for direct loading onto agarose gels.
Exhibits approximately 80-fold higher fidelity than Taq DNA polymerase — advantageous for applications such as preparing long target amplicons for sequencing.
Effective for amplification from crude samples (biological samples, foodstuffs, soil extract, etc.). Various samples or lysates can be used directly as templates.
Can use primers or templates containing inosines (dI) or uracils (dU), whereas conventional high-fidelity PCR enzymes cannot.
Details
Components
| Code No. | Component | Size |
|---|---|---|
| TYB-KMM-101-10PK | KOD One™ PCR Master Mix | 10 pack X (1 mL × 5) |
Application Data
Manufacturer performance data (TOYOBO).
Example 1
Fast PCR
Various targets were amplified with KOD One™ PCR Master Mix and KOD One™ PCR Master Mix -Blue- using ultra-fast cycling conditions. The KOD One™ series successfully amplified all targets.
Example 2
Amplification from cDNA
The inhibitory effect of RNA in cDNA was compared using various PCR enzymes. KOD One™ Master Mix was not susceptible to RNA inhibition and was able to amplify targets under high concentrations of cDNA.
Example 3
PCR error ratio
The error ratio of various PCR enzymes was compared by determining the sequences of amplicons from the human β-globin gene. The amplicons were cloned into the vector using TArget clone™ -Plus- (Code No. TAK-201) and the sequences were determined. KOD One™ PCR Master Mix and KOD One™ PCR Master Mix -Blue- showed excellent fidelity, with mutation frequencies approximately 80 times lower than Taq DNA polymerase.
Example 4
Amplification using degenerate primers, containing inosine (I)
2.8 kb fragments were amplified using degenerate primers containing inosine (I). KOD One™ PCR Master Mix was able to amplify these targets, whereas conventional high-fidelity PCR enzymes cannot.
Fwd: ATGGTICARATHCCICARAAY
Rev: RTGIGCYTGRTCCCARTTYTC
Example 5
Amplification from crude samples
Amplification from whole blood and from mouse lysate were compared. KOD One™ PCR Master Mix amplified the targets efficiently.
Example 6
Amplification of NGS library — Minimal amplification bias
An NGS library of Thermus thermophilus genome (GC content 70%) was amplified using KOD One™ PCR Master Mix and another company’s product, and the amplified libraries were sequenced on an Illumina MiSeq. This examined the GC bias of the amplified libraries. Normalized coverages (blue plot) close to 1 indicate low bias. KOD One™ PCR Master Mix showed lower GC bias than the other company’s product.
Fwd: AATGATACGGCGACCACCGAGATC
Rev: CAAGCAGAAGACGGCATACGAG
Please see below for library input amounts and cycle numbers. (The optimal number of cycles may vary by 1 to 3 cycles depending on sample type and template size distribution.)
| Library input amount | Number of cycles |
|---|---|
| 1 µg | 0–1 |
| 500 ng | 1–2 |
| 100 ng | 4–5 |
| 50 ng | 5–6 |
| 10 ng | 8–10 |
| 1 ng | 13–15 |
| 0.25 ng | 16–18 |
Compared to other products in PCR Master Mix
Third-party experimental data — head-to-head performance vs. competitor master mixes.
KOD One is superior to Q5.
In this comparison
- Greater than ten times better than ThermoFisher DreamTaq for High GC Content PCR
- Greater than ten times better than Invitrogen or ThermoFisher Platinum Taq (High Fidelity Fast PCR)
- Three times better than NEB OneTaq (Expression Analysis by PCR)
- 30% to 46% lower price than NEB Q5
- Five times better GC-Rich Region gDNA PCR result than Takara GXL System or Clontech GXL System
- More than ten times better amplification from crude samples than other brands
- 11 kb long range for all organisms with high fidelity (10Kb+ gDNA Long Range PCR)
- 80 times higher fidelity than Taq DNA polymerase and Top Class in the market
- Ten times faster than traditional PCR enzymes (1kb per one-second extension)
- More than ten times better amplification with RNase inhibitors
(1) Greater than ten times better than ThermoFisher DreamTaq for High GC Content PCR
Do you have a high GC content or tough gene to amplify? KOD One High Fidelity PCR master mix is ten times better than DreamTaq (Thermo Fisher) for high GC content template (amplification of the PIPPA gene region). No band due to a really tough GC region? KOD One (product #TYB-KMM-101 or 201 series) is 10× superior to DreamTaq, generating that band for you from all high GC content regions.
(2) Greater than ten times better than Invitrogen or ThermoFisher Platinum Taq (High Fidelity Fast PCR)
Wish to generate solid PCR bands? KOD One Master Mix (product #TYB-KMM-101 or 201 series) is more than ten times better than Invitrogen | Thermo Fisher Platinum Taq (amplification of the XTL1127 region). KOD One is an extremely effective enzyme that will amplify tough genes and DNA templates. Abundant PCR amplification allows you to load a small amount of PCR product and save PCR samples for later use.
(3) Three times better than NEB OneTaq (Expression Analysis by PCR)
Want something better and stronger than NEB OneTaq? KOD One PCR master mix (product #TYB-KMM-101 or 201 series) is at least three times better than OneTaq for amplifying tough templates. Researchers confirm 3× superior amplification for A5 and B6 genes and make solid PCR bands. It is an excellent enzyme to amplify low-abundance genes and tough genomic regions.
(4) 30% to 46% lower price than NEB Q5
Want to save budget? KOD One PCR master mix (product #TYB-KMM-101 or 201 series) will save you 50% compared to NEB Q5. Buying one unit saves near 30%. Buy 5-set bundles and save more than 35% compared to major brands in the market. Buy a 10-set bundle and the KOD One mix is near half price compared to other name brands. Price comparison data showed KOD One master mix is the top choice for high-fidelity PCR master mix and the biggest bang for the buck in the market.
(5) Five times better GC-Rich Region gDNA PCR result than Takara GXL System or Clontech GXL System
Want to maximize PCR amplification in the tough template region? KOD One PCR master mix (product #TYB-KMM-101 or 201 series) amplifies five times better than the Takara GXL System. KOD One mix generates bands from tough templates with 3× superior amplification compared to Clontech GXL. KOD One mix is excellent for amplification of long amplicons (10Kb+), high GC-rich regions, low-expressed genes, and secondary-structure templates.
(6) More than ten times better amplification from crude samples than other brands
High efficiency: excellent amplification from crude samples. Cannot generate a PCR band from a crude sample and unpurified templates? KOD will do it for you. KOD One PCR master mix (product #TYB-KMM-101 or 201 series) is an extremely efficient enzyme that can work on crude and dirty samples — more than ten times better than other major brands. With 10× superiority compared to other major brands and some optimization, generating a PCR band from crude samples can be done without much preparation.
(7) 11 kb long range for all organisms with high fidelity (10Kb+ gDNA Long Range PCR)
25 µL Rx vol., 25–35 cycles, gDNA long-range PCR. Need a long-range PCR? 10 kb or more with minimum errors? KOD One PCR master mix (product #TYB-KMM-101 or 201 series) can provide greater than 10Kb and will satisfy all long-range PCR experiments. Long PCR works from bacteria to humans with difficult regions on DNA templates. KOD One is highly efficient in generating large-size PCR bands with minimal errors (1 error in 10 million base pairs).
(8) 80 times higher fidelity than Taq DNA polymerase and Top Class in the market
Want a top high-fidelity PCR enzyme and robust amplification of high GC content, long PCR, and crude samples with minimum errors? Look no further: KOD One PCR master mix (product #TYB-KMM-101 or 201 series) works above and beyond to give you a PCR band at the lowest price per reaction. It is the top-class high-fidelity PCR enzyme master mix in the market — 80 times higher fidelity than traditional Taq DNA polymerase, and the most robust PCR enzyme engineered to give you the PCR band you need.
(9) Ten times faster than traditional PCR enzymes (1kb per one-second extension)
Looking for a lightning-fast PCR enzyme? KOD One PCR master mix (product #TYB-KMM-101 or 201 series) amplifies ten times faster than traditional PCR enzyme mixes. 1 kb elongation per 1 second extension time gives you 10× faster PCR to shorten bench time and quickly see results. Shorten your PCR time for long-range amplification with minimum error — a superior, fast enzyme for amplicons of 10 kb and more, from all sample sources including crude preparations.
(10) More than ten times better amplification with RNase inhibitors
Need a robust PCR enzyme that tolerates RNase inhibitors? KOD One PCR master mix (product #TYB-KMM-101 or 201 series) is more than ten times better than other major brands at amplifying PCR bands with RNase inhibitors in the reaction. Samples with RNase inhibitors are no problem with the KOD enzyme mix — no band or weak band becomes a solid, bright PCR band on your gel. Minimum errors, high fidelity, large PCR bands, and lightning-fast amplification for all sample sources including crude samples. This next-generation high-fidelity PCR enzyme is engineered to amplify PCR bands from GC-rich regions and tough templates.
Ordering Information
| Product | Cat No. | Size | Order |
|---|---|---|---|
| KOD One™ PCR Master Mix, 1 pack | TYB-KMM-101 | (1 mL × 5) | Order |
| KOD One™ PCR Master Mix, 5 pack | TYB-KMM-101-5PK | (1 mL × 5) × 5 | Order |
| KOD One™ PCR Master Mix, 10 pack | TYB-KMM-101-10PK | (1 mL × 5) × 10 | Current page |
| KOD One™ PCR Master Mix, Trial (Only 1 Per Customer) | TYB-KMM-101S | Trial size | Order |
Publications
Literature citing KOD One™ PCR Master Mix, summarized by Bioz.
References / Citations
- Okhovat M. et al. TAD evolutionary and functional characterization reveals diversity in mammalian TAD boundary properties and function. Nat Commun. 2023 Dec 7;14(1):8111.
- Melesio, J., Bonilauri, B., Li, A., Pang, P. D., Liao, R., Witteles, R. M., Wu, J. C., & Sallam, K. (2023). Generation of two induced pluripotent stem cell lines from hereditary amyloidosis patients with polyneuropathy carrying heterozygous transthyretin (TTR) mutation. Stem Cell Research, 74, 103265. https://doi.org/10.1016/j.scr.2023.103265
- Kojic, A., Kim, H., Guevara, J. V., Ravada, S., Sallam, K., & Wu, J. C. (2022). Generation of two induced pluripotent stem cell lines from dilated cardiomyopathy patients carrying heterozygous FLNC mutations. Stem Cell Research, 64, 102928. https://doi.org/10.1016/j.scr.2022.102928
- Yildirim, Z., Kojic, A., Yan, C. D., Wu, M. A., Vagelos, R., & Wu, J. C. (2022). Generation of two induced pluripotent stem cell lines from dilated cardiomyopathy patients caused by heterozygous mutations in the HCN4 gene. Stem Cell Research, 65, 102951. https://doi.org/10.1016/j.scr.2022.102951
- Zeng, W., Kong, X., Alamana, C., Liu, Y., Guzman, J., Pang, P. D., Day, J. W., & Wu, J. C. (2023). Generation of two induced pluripotent stem cell lines from spinal muscular atrophy type 1 patients carrying no functional copies of the SMN1 gene. Stem Cell Research, 69, 103095. https://doi.org/10.1016/j.scr.2023.103095
- Chen, Y. I., Caudal, A., Flores-Banuelos, A. G., Yan, C. D., Park, W. G., Viswanathan, M., & Wu, J. C. (2025). Generation of two induced pluripotent stem cell lines from breast cancer patients carrying BRCA1 mutations. Stem Cell Research, 86, 103716. https://doi.org/10.1016/j.scr.2025.103716
- Gao, J., Li, J., Xu, L., Yan, C. D., Knowles, J. W., & Wu, J. C. (2024). Generation of two familial hypercholesterolemia patient-specific induced pluripotent stem cell lines harboring heterozygous mutations in the LDLR gene. Stem Cell Research, 78, 103463. https://doi.org/10.1016/j.scr.2024.103463
- Bonilauri, B., Shin, H. S., Htet, M., Yan, C. D., Witteles, R. M., Sallam, K., & Wu, J. C. (2023). Generation of two induced pluripotent stem cell lines from patients with cardiac amyloidosis carrying heterozygous transthyretin (TTR) mutation. Stem Cell Research, 72, 103215. https://doi.org/10.1016/j.scr.2023.103215
